PDFPrintE-mail

 


Public Oligonucleotide Database of LRB



Transcript (Accesion No.)

Primers/probe sequences

Kv11.1 (U87513)

forward: 5'-GCTCATTGGCTCCCTCATG-3' 
reverse: 5'-CCGAGTACAGCCGCTGGAT-3' 
probe: 5'-FAM-TTCGGCAACGTGTCCGCCAT-TAMRA-3'

Kv7.1 (AJ291316)

forward: 5'-AGGAGCTGATCACCA-3' 
reverse: 5'-GTAGGAGGAGAAGATG-3' 
probe: 5'-FAM-AGGCCGAGGAAGCCGATGTA-TAMRA-3'

Kv4.2 (AF493547)

forward: 5'-CAGATCAGATGTGTGGAGAGAACA-3' 
reverse: 5'-CACAGTTTAGTTTAACACACTCTTCCAT-3' 
probe: 5'-FAM-TGTCTAACAGCCGATCCAGTTTAAATGCCA-TAMRA-3'

Kv4.3 (AF085170)

forward: 5'-ATTGATGAGCAGATG-3' 
reverse: 5'-GTAGTTCTGCATTGA-3' 
probe: 5'-FAM-TCTCCATGCAGTTCTGCT-TAMRA-3'

18S rRNA (EF060919)

forward: 5'-GAGGGAGCCTGAGAAACGG-3' 
reverse: 5'-GTCGGGAGTGGGTAATTTGC-3' 
probe: 5'-FAM-TACCACATCCAAGGAAGGCAGCAGG-TAMRA-3'

HIV-1 PR D25K

forward: 5'-GAAGCTCTGCTGAAGACTGGCGCTGACGATACC-3' 
reverse: 5'-GGTATCGTCAGCGCCAGTCTTCAGCAGAGCTTC-3'

HIV-1 PR D25R

forward: 5'-GAAGCTCTGCTGCGTACTGGCGCTGACGATACC-3' 
reverse: 5'-GGTATCGTCAGCGCCAGTACGCAGCAGAGCTTC-3'

HIV-1 PR D25W

forward: 5'-GAAGCTCTGCTGTGGACTGGCGCTGACGATACCG-3' 
reverse: 5'-CGGTATCGTCAGCGCCAGTCCACAGCAGAGCTTC-3'

HIV-1 PR G49E

forward: 5'-CCAAAAATGATAGGGGAAATTGGAGGTTTTATCAAAG-3' 
reverse: 5'-CTTTGATAAAACCTCCAATTTCCCCTATCATTTTTGG-3'

HIV-1 PR G49W/I50W

forward: 5'-CCAAAAATGATAGGGTGGTGGGGAGGTTTTATCAAAG-3'
reverse: 5'-CTTTGATAAAACCTCCCCACCACCCTATCATTTTTGG-3'

HIV-1 PR D25R/G49E/I50R

forward: 5'-CCAAAAATGATAGGGGAAAGAGGAGGTTTTATCAAAGTAAGAC-3' 
reverse: 5'-GTCTTACTTTGATAAAACCTCCTCTTTCCCCTATCATTTTTGG-3'

CMV promoter

forward: 5'-GCGGGATCCGGAGTTCCGCGTTACATAAC-3'
reverse: 5'-CGCACGCGTGCGCTCTGCTTATATAG-3'

pMDLg/pRRE D25K

forward: 5'-GGCAATTAAAGGAAGCTCTATTAAAGACAGGAGCAGATGATACAG-3'
reverse: 5'-CTGTATCATCTGCTCCTGTCTTTAATAGAGCTTCCTTTAATTGCC-3'

pMDLg/pRRE D25R

forward: 5'-GGCAATTAAAGGAAGCTCTATTACGTACAGGAGCAGATGATACAG-3'
reverse: 5'-CTGTATCATCTGCTCCTGTACGTAATAGAGCTTCCTTTAATTGCC-3'

pMDLg/pRRE dN

A (outer, forward): 5'-GGCCCCTAGGAAAAAGGGCTGTTGGAAATG-3'
B (inner, reverse): 5'-GGGTCGCTGCCAAAGAGTGAAGCTAAAGG-3'
C (inner, forward): 5'-CCTTTAGCTTCACTCTTTGGCAGCGACCC-3'
D (outer, reverse): 5'-GGGCCCTGCAGGATGTGGTATTCCTAATTG-3'

pMDLg/pRRE dC

A (outer, forward): 5'-GGCCCCTAGGAAAAAGGGCTGTTGGAAATG-3'
B (inner, reverse): 5'-CAATAGGACTAATGGGAGTGCAGCCAATC-3'
C (inner, forward): 5'-GATTGGCTGCACTCCCATTAGTCCTATTG-3'
D (outer, reverse): 5'-GGGCCCTGCAGGATGTGGTATTCCTAATTG-3'

PAI-1

forward: 5'- ATCTTCGTCCAGCGG -3'

probe: 5'- FAM-ATCTGAAGCTGGTCCAGGGCTTCA-TAMRA -3'

reverse : 5'- GCCTGAAGAAGTGGG -3'

PAI-2

forward: 5'- GCTCTGCAATCAATGCA -3'

probe: 5'- FAM-ACAGGGGATTATTTACTGGAAAGTGTCA- TAMRA -3'

reverse:  5'- GACTTCTCACCAAACAG -3'

uPA

forward: 5'- GCGCTGACACGCTTGCT – 3’

probe: 5'- FAM-ACCACAACGACATTGCCTTGCTGAAGA-TAMRA – 3’

reverse: 5'- CACCTGCCCTCCTTGGAA – 3’

tPA

forward: 5’- GTGCCCCGAAGGATTTG – 3’

probe: 5'- FAM-ACGTGGCCCTGGTATCTATTTCACAGCA-TAMRA – 3’

reverse : 5'- ATGCCCTGGTCCTCGTA – 3’

HIV-1 CA W23A

forward: 5’-CAC CTA GAA CTT TAA ATG CAG CGG TAA AAG TAG TAG AAG AGA AGG-3’

reverse: 5’- CCT TCT CTT CTA CTA CTT TTA CCG CTG CAT TTA AAG TTC TAG GTG-3’

HIV-1 CA A77P

forward: 5’-GAC CAT CAA TGA GGA ACC TGC AGA ATG GGA TAG AG-3’

reverse: 5’-CTC TAT CCC ATT CTG CAG GTT CCT CAT TGA TGG TC-3’

HIV-1 CA A78V

forward: 5’-CCA TCA ATG AGG AAG CTG TAG AAT GGG ATA GAG TAC-3’

reverse: 5’-GTA CTC TAT CCC ATT CTA CAG CTT CCT CAT TGA TGG-3’

HIV-1 CA L189F

forward: 5’-GGA TGA CAG AAA CCT TCT TGG TCC AAA ATG CGA AC-3’

reverse: 5’-GTT CGC ATT TTG GAC CAA GAA GGT TTC TGT CAT CC-3’

HIV-1 CA L189I

forward: 5’-AAT TGG ATG ACA GAA ACC ATC TTG GTC CAA AAT GCG AAC-3’

reverse: 5’-GTT CGC ATT TTG GAC CAA GAT GGT TTC TGT CAT CCA ATT-3’

HIV-1 CA L189P

forward: 5’-AAT TGG ATG ACA GAA ACC CCG TTG GTC CAA AAT GCG AAC-3’

reverse: 5’-GTT CGC ATT TTG GAC CAA CGG GGT TTC TGT CAT CCA ATT-3’

HIV-2 PR D25N

Asp25 - Asn25

5’ GAAGTTTTGTTAAATACGGGAGCTGAC 3’

HIV-2 Tat  Y44A

Tyr44 - Ala44 (GCC)

5’CTCTCTCAGCTAGCCCGACCCCTAGAAAC 3'

HIV-2 Rev H73R

H73 - R73

5' CCAGACTATACAGCGTCTGCAGGGACTTAC  3'

HIV-2 Vif S144A

Ser144 - Ala144

5' GAGCCCAGGTACCGGCACTTCAATTTCTG 3'

HIV-2 Vpr R78A

Arg78 - Ala78

5' TTCACGCACTTCGCAGCAGGATGTGGCC 3'

HIV-2Vpx K68A, R70A

Lys68 - Ala68

Arg70  – Ala70

5' GGGATGTCAGAAAGTTACACAGCGTATAGATATTTGTGCATAATACAG 3'

5' GTTACACAGCGTATGCATATTTGTGCATAATACAG 3'

N1

5’-GAGAACCTGTACTTCCAGGGTGGTGCATCTACACGCGG

TTTAATTAATCTTCTGCTAGCATGGTGAGCAAGGGCG-3’

N2

5’-GGGGACAAGTTTGTACAAAGCAGGCTCGGAGAACCTGTACTTCCAG-3’

C

5’-GGGGACACACTTTGTACAAGAAAGCTGGGTTATTACTTGTA

CAGCTCGTCCAT-3’

pDest-His6-MBP-FP sequencing FW

5'-GATGAAGCCCTGAAAGACGCGCAG-3'

pDest-His6-MBP-HIV-1 MA/CA P5-P4' FW

5’-TAAAGTGAGCCAGAACTATCCGATTGTGCAGG-3’

pDest-His6-MBP-HIV-1 MA/CA P5-P4' REV

5’-CTAGCCTGCACAATCGGATAGTTCTGGCTCACTTTAAT-3’

 

 

joomla template